Actinoplanes friuliensis: AFR_29230 Help Entry AFR_29230         CDS       T02892                                  Name (GenBank) MbtH-like protein   KO K05375   MbtH protein Organism afs  Actinoplanes friuliensis Pathway afs00261   Monobactam biosynthesis afs01100   Metabolic pathways afs01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:afs00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     AFR_29230  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:afs01008]     AFR_29230 Polyketide biosynthesis proteins [BR:afs01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     AFR_29230 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  AGZ44107 UniProt:  U5W526 LinkDB All DBs Position complement(6351714..6351935) Genome browser AA seq 73 aa AA seqDB search MSNPFEREDISYFVLVNDEGQHSLWPEVIDVPAGWRTVSGPESREDCLAYIERSWWDIRP ASLITRMASAQNG NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atgagcaacccgttcgaacgcgaggacatcagctacttcgtgctggtcaacgacgaagga cagcactcgctgtggccggaggtgatcgatgtgccggccggctggcgtaccgtgtcgggc ccggagagccgcgaggattgcctggcctacatcgagaggtcgtggtgggacatccggccg gcgagcctgatcacccgcatggcctcggcgcagaacggatga

DBGET integrated database retrieval system