Eremothecium gossypii: AGOS_AFR026C Help Entry AGOS_AFR026C      CDS       T00167                                  Name (RefSeq) AFR026Cp   KO K03009   DNA-directed RNA polymerases I, II, and III subunit RPABC4 Organism ago  Eremothecium gossypii Pathway ago03020   RNA polymerase ago03420   Nucleotide excision repair Brite KEGG Orthology (KO) [BR:ago00001]  09120 Genetic Information Processing   09121 Transcription    03020 RNA polymerase     AGOS_AFR026C   09124 Replication and repair    03420 Nucleotide excision repair     AGOS_AFR026C  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03021 Transcription machinery [BR:ago03021]     AGOS_AFR026C    03400 DNA repair and recombination proteins [BR:ago03400]     AGOS_AFR026C Transcription machinery [BR:ago03021]  Eukaryotic type   RNA polymerase II system    RNA polymerase II     Pol I, II, III common subunits      AGOS_AFR026C   RNA polymerase III system    RNA polymerase III      AGOS_AFR026C   RNA polymerase I system    RNA polymerase I      AGOS_AFR026C DNA repair and recombination proteins [BR:ago03400]  Eukaryotic type   SSBR (single strand breaks repair)    NER (nucleotide excision repair)     TCR (transcription coupled repair) factors      DNA-directed RNA polymerase II complex       AGOS_AFR026C BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  DNA_RNApol_7kD DZR_2 Zn_ribbon_SprT DZR HypA MCM_OB zinc_ribbon_10 zinc-ribbon_6 FtrD-like DUF5816 Motif Other DBs NCBI-GeneID:  4621813 NCBI-ProteinID:  NP_985573 UniProt:  Q754P6 LinkDB All DBs Position VI:complement(488510..488722) Genome browser AA seq 70 aa AA seqDB search MSREGFQIPTNLDAAAAGTAQARTATLKYICAECSGKLSLSRTDPVRCKNCGHRILLKAR TKRMVQFEAR NT seq 213 nt NT seq  +upstreamnt  +downstreamnt atgtcccgcgaaggcttccaaatcccgacgaatctagacgcggctgccgccggtaccgcc caggcgcgcactgcgaccctcaagtacatctgcgcggagtgctccggcaagctctcgctg tccaggaccgacccggtgcgctgcaagaactgcggccaccgcatcctgctcaaggcccgc accaagcgcatggtgcagttcgaggccaggtga

DBGET integrated database retrieval system