Christensenella minuta: B1H56_01330 Help Entry B1H56_01330       CDS       T05665                                  Name (GenBank) ferredoxin family protein   KO K00176   2-oxoglutarate ferredoxin oxidoreductase subunit delta [EC:1.2.7.3] Organism cmiu  Christensenella minuta Pathway cmiu00020   Citrate cycle (TCA cycle) cmiu01100   Metabolic pathways cmiu01110   Biosynthesis of secondary metabolites cmiu01120   Microbial metabolism in diverse environments cmiu01200   Carbon metabolism cmiu01210   2-Oxocarboxylic acid metabolism Brite KEGG Orthology (KO) [BR:cmiu00001]  09100 Metabolism   09101 Carbohydrate metabolism    00020 Citrate cycle (TCA cycle)     B1H56_01330 Enzymes [BR:cmiu01000]  1. Oxidoreductases   1.2  Acting on the aldehyde or oxo group of donors    1.2.7  With an iron-sulfur protein as acceptor     1.2.7.3  2-oxoglutarate synthase      B1H56_01330 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Fer4 Fer4_7 Fer4_2 Fer4_10 Fer4_21 Fer4_9 Fer4_15 Fer4_6 Fer4_4 Fer4_22 Fer4_16 Fer4_13 Fer4_17 Fer4_8 Fer4_3 Fer4_18 Motif Other DBs NCBI-ProteinID:  AYH39249 UniProt:  A0A136Q627 LinkDB All DBs Position 272457..272663 Genome browser AA seq 68 aa AA seqDB search MAKLTIYEDTCKGCGLCIGACPKELLAIDKSHLNAKGYHPIGIEHMEDCIGCASCARMCP DCALEVDK NT seq 207 nt NT seq  +upstreamnt  +downstreamnt atggcaaaattaacaatttatgaggatacgtgcaagggctgcggcctgtgcatcggtgcg tgcccgaaggaacttttggcgatcgataaatcgcacctcaatgcgaagggatatcatccg atcgggatcgaacatatggaggactgtatcggctgtgcatcgtgcgcgcgtatgtgcccg gattgtgcgctcgaagtagacaaataa

DBGET integrated database retrieval system