Eremothecium cymbalariae: Ecym_6409 Help Entry Ecym_6409         CDS       T02237                                  Name (RefSeq) hypothetical protein   KO K03009   DNA-directed RNA polymerases I, II, and III subunit RPABC4 Organism erc  Eremothecium cymbalariae Pathway erc03020   RNA polymerase erc03420   Nucleotide excision repair Brite KEGG Orthology (KO) [BR:erc00001]  09120 Genetic Information Processing   09121 Transcription    03020 RNA polymerase     Ecym_6409   09124 Replication and repair    03420 Nucleotide excision repair     Ecym_6409  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03021 Transcription machinery [BR:erc03021]     Ecym_6409    03400 DNA repair and recombination proteins [BR:erc03400]     Ecym_6409 Transcription machinery [BR:erc03021]  Eukaryotic type   RNA polymerase II system    RNA polymerase II     Pol I, II, III common subunits      Ecym_6409   RNA polymerase III system    RNA polymerase III      Ecym_6409   RNA polymerase I system    RNA polymerase I      Ecym_6409 DNA repair and recombination proteins [BR:erc03400]  Eukaryotic type   SSBR (single strand breaks repair)    NER (nucleotide excision repair)     TCR (transcription coupled repair) factors      DNA-directed RNA polymerase II complex       Ecym_6409 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  DNA_RNApol_7kD DZR_2 DZR Zn_ribbon_SprT MCM_OB zinc_ribbon_10 HypA DUF5816 zinc-ribbon_6 Ribosomal_L40e FtrD-like FYDLN_acid Zn-ribbon_8 Motif Other DBs NCBI-GeneID:  11471145 NCBI-ProteinID:  XP_003647599 UniProt:  G8JUK2 LinkDB All DBs Position 6:794980..795192 Genome browser AA seq 70 aa AA seqDB search MSREGFQIPTNLDAAAAGTAQARTATLKYICAECSSKLSLSRTDPVRCKNCGHRILLKAR TKRMVQFEAR NT seq 213 nt NT seq  +upstreamnt  +downstreamnt atgtcccgcgaaggttttcagattccgacaaatttggacgcagcagctgcaggtactgcg caagcaagaactgcgacgttgaagtacatctgtgcagaatgctcgagcaaattgtcgcta tctcggacggacccagtgcggtgcaagaactgtggtcataggattctgctcaaggccagg accaagagaatggttcaatttgaagctagatga

DBGET integrated database retrieval system