Mycolicibacterium vanbaalenii: Mvan_3842 Help Entry Mvan_3842         CDS       T00449                                  Name (GenBank) MbtH domain protein   KO K05375   MbtH protein Organism mva  Mycolicibacterium vanbaalenii Pathway mva00261   Monobactam biosynthesis mva01100   Metabolic pathways mva01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mva00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     Mvan_3842  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:mva01008]     Mvan_3842 Polyketide biosynthesis proteins [BR:mva01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     Mvan_3842 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  ABM14623 UniProt:  A1TBS3 LinkDB All DBs Position complement(4093391..4093621) Genome browser AA seq 76 aa AA seqDB search MSTNPFDDDPAGSARTFYVLVNDEEQYSLWPAFADVPAGWRVVFGESTRADCLAYVEETW TDLRPRSLRDAMAGDR NT seq 231 nt NT seq  +upstreamnt  +downstreamnt atgagcaccaacccgttcgatgacgacccggctggttcggcccgcaccttctacgtgctg gtcaacgacgaggagcagtacagcctgtggcccgcgttcgccgacgtgcccgcgggctgg cgcgtcgtgttcggggagagcacccgcgccgactgcctggcctacgtcgaggagacgtgg accgacctgcgcccgcgcagcctgcgcgacgcgatggccggcgatcgctag

DBGET integrated database retrieval system