Myxococcus xanthus: MXAN_3118 Help Entry MXAN_3118         CDS       T00366                                  Name (GenBank) MbtH-like domain protein   KO K05375   MbtH protein Organism mxa  Myxococcus xanthus Pathway mxa00261   Monobactam biosynthesis mxa01100   Metabolic pathways mxa01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mxa00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     MXAN_3118  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:mxa01008]     MXAN_3118 Polyketide biosynthesis proteins [BR:mxa01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     MXAN_3118 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  ABF91873 UniProt:  Q1D7Q2 LinkDB All DBs Position complement(3654935..3655150) Genome browser AA seq 71 aa AA seqDB search MTDEREDTTVYKVVVNHEEQYSIWPADRENALGWKDAGKQGLKAECLEYIKEVWTDMRPL SLRKKMEELKS NT seq 216 nt NT seq  +upstreamnt  +downstreamnt atgacggatgagcgagaggacacgaccgtctacaaggtcgtggtgaaccacgaggagcag tactccatctggccggccgaccgcgagaacgcgctcggctggaaggatgcaggcaagcag ggcctcaaggccgagtgcctggagtacatcaaggaggtctggacggacatgcgtccgctg agcctccgcaagaagatggaagagctgaagtcgtag

DBGET integrated database retrieval system