Pseudomonas sp. ATCC 13867: H681_12885 Help Entry H681_12885        CDS       T02524                                  Name (GenBank) MbtH-like protein   KO K05375   MbtH protein Organism pdr  Pseudomonas sp. ATCC 13867 Pathway pdr00261   Monobactam biosynthesis pdr01100   Metabolic pathways pdr01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pdr00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     H681_12885  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:pdr01008]     H681_12885 Polyketide biosynthesis proteins [BR:pdr01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     H681_12885 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  AGI24447 UniProt:  M4X0C9 LinkDB All DBs Position complement(2897945..2898154) Genome browser AA seq 69 aa AA seqDB search MAFDREDAVYKVLVNGEEQYSLWPDYKEVPAGWREAGQQGSKADCLAFVERNWTDMRPLS LRQKMAEGQ NT seq 210 nt NT seq  +upstreamnt  +downstreamnt atggcattcgatcgcgaagacgcggtgtacaaggtcctggtcaacggcgaggagcagtac tcgctgtggccggactacaaggaagtccccgccggctggcgcgaagccggccagcagggc agcaaggccgattgcctggccttcgtcgagcgcaactggaccgacatgcgtccgttgagc ctgcgacagaagatggccgaggggcagtaa

DBGET integrated database retrieval system