Paenibacillus lentus: EIM92_18435 Help Entry EIM92_18435       CDS       T05914                                  Name (GenBank) MbtH family protein   KO K05375   MbtH protein Organism plen  Paenibacillus lentus Pathway plen00261   Monobactam biosynthesis plen01100   Metabolic pathways plen01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:plen00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     EIM92_18435  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:plen01008]     EIM92_18435 Polyketide biosynthesis proteins [BR:plen01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     EIM92_18435 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  AZK47898 UniProt:  A0A3S8RYA7 LinkDB All DBs Position complement(4075958..4076176) Genome browser AA seq 72 aa AA seqDB search MANPFEQADGVYLVLVNREGQYSIWPAFIQVPAGWKVALNENTREACLEYIESNWKDMRP LSLQYAAPVDAI NT seq 219 nt NT seq  +upstreamnt  +downstreamnt atggcaaatccatttgaacaagcagatggcgtttatcttgtacttgtgaacagggaaggg cagtattccatttggcccgcattcattcaggtgcctgcaggctggaaggttgctctgaac gagaacacgagagaggcatgtcttgaatatattgaatcgaattggaaagatatgcgcccc ctttctttacaatatgcagcaccagtagatgcgatttaa

DBGET integrated database retrieval system