Paenibacillus sophorae: KP014_18770 Help Entry KP014_18770       CDS       T07500                                  Name (GenBank) hypothetical protein   KO K00230   menaquinone-dependent protoporphyrinogen oxidase [EC:1.3.5.3] Organism psop  Paenibacillus sophorae Pathway psop00860   Porphyrin metabolism psop01100   Metabolic pathways psop01110   Biosynthesis of secondary metabolites psop01240   Biosynthesis of cofactors Brite KEGG Orthology (KO) [BR:psop00001]  09100 Metabolism   09108 Metabolism of cofactors and vitamins    00860 Porphyrin metabolism     KP014_18770 Enzymes [BR:psop01000]  1. Oxidoreductases   1.3  Acting on the CH-CH group of donors    1.3.5  With a quinone or related compound as acceptor     1.3.5.3  protoporphyrinogen IX dehydrogenase (quinone)      KP014_18770 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-ProteinID:  QWU13977 LinkDB All DBs Position complement(3977431..3977688) Genome browser AA seq 85 aa AA seqDB search MYVERKKAHERGESEDKAGLELLRSFPESMYLRAKAAEVLGNEVKYSKLPLTERLIYRAV TGKSGDRGRLYTKRIESFVSKLLDE NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atgtacgtagagaggaagaaagcccatgaaagaggcgagtcagaggataaggccgggctg gagcttctgcgttcctttccggagagcatgtatttgagagccaaggctgctgaagtgctg ggcaacgaagtcaaatatagcaagctgccactgacggaaaggctgatctaccgggcggtg acaggaaaaagcggtgacaggggccgattatatactaaacgaattgagagtttcgtttcc aagctgctggatgaatga

DBGET integrated database retrieval system