Pseudomonas triclosanedens: OU419_13675 Help Entry OU419_13675       CDS       T09689                                  Name (GenBank) MbtH family protein   KO K05375   MbtH protein Organism ptrl  Pseudomonas triclosanedens Pathway ptrl00261   Monobactam biosynthesis ptrl01100   Metabolic pathways ptrl01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ptrl00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     OU419_13675  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:ptrl01008]     OU419_13675 Polyketide biosynthesis proteins [BR:ptrl01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     OU419_13675 BRITE hierarchy Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  WAI52250 LinkDB All DBs Position 2932071..2932289 Genome browser AA seq 72 aa AA seqDB search MAFDREDAVYKVLVNGEEQYSLWPDYKEVPAGWREAGQRGSKAECLAFVERHWTDMRPLS LRQKMDGPVAGR NT seq 219 nt NT seq  +upstreamnt  +downstreamnt atggcattcgatcgcgaagatgcggtgtacaaggttctggtcaacggcgaggagcaatac tcgctgtggcccgattacaaggaagtccccgccggctggcgcgaagccggtcagcgcggc agcaaggcggagtgcctggccttcgtggagcgtcactggaccgacatgcgcccgctgagc ctgcgacagaagatggacggcccggtggcggggcgctga

DBGET integrated database retrieval system