Phaseolus vulgaris (common bean): PHAVU_004G138700g Help Entry PHAVU_004G138700g CDS       T03093                                  Name (RefSeq) hypothetical protein   KO K03009   DNA-directed RNA polymerases I, II, and III subunit RPABC4 Organism pvu  Phaseolus vulgaris (common bean) Pathway pvu03020   RNA polymerase pvu03420   Nucleotide excision repair Brite KEGG Orthology (KO) [BR:pvu00001]  09120 Genetic Information Processing   09121 Transcription    03020 RNA polymerase     PHAVU_004G138700g   09124 Replication and repair    03420 Nucleotide excision repair     PHAVU_004G138700g  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03021 Transcription machinery [BR:pvu03021]     PHAVU_004G138700g    03400 DNA repair and recombination proteins [BR:pvu03400]     PHAVU_004G138700g Transcription machinery [BR:pvu03021]  Eukaryotic type   RNA polymerase II system    RNA polymerase II     Pol I, II, III common subunits      PHAVU_004G138700g   RNA polymerase III system    RNA polymerase III      PHAVU_004G138700g   RNA polymerase I system    RNA polymerase I      PHAVU_004G138700g DNA repair and recombination proteins [BR:pvu03400]  Eukaryotic type   SSBR (single strand breaks repair)    NER (nucleotide excision repair)     TCR (transcription coupled repair) factors      DNA-directed RNA polymerase II complex       PHAVU_004G138700g BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  DNA_RNApol_7kD YjdM_Zn_Ribbon DUF5816 zinc_ribbon_13 OrfB_Zn_ribbon HypA Motif Other DBs NCBI-GeneID:  18632993 NCBI-ProteinID:  XP_007152540 UniProt:  V7C304 LinkDB All DBs Position 4:41718874..41720794 Genome browser AA seq 51 aa AA seqDB search MDPQPEPVSYICGDCGMENTLKPGDVIQCRECGYRILYKKRTRRIVQYEAR NT seq 156 nt NT seq  +upstreamnt  +downstreamnt atggatcctcagcctgagccggtcagctacatctgcggagattgtggcatggagaatacg ctgaagcctggtgacgttatacagtgccgcgagtgcggttaccgtattctttacaagaag cgcactcgtcgcattgtccaatacgaggcccgctga

DBGET integrated database retrieval system