Streptomyces formicae: KY5_0492c Help Entry KY5_0492c         CDS       T05416                                  Name (GenBank) MbtH protein   KO K05375   MbtH protein Organism sfk  Streptomyces formicae Pathway sfk00261   Monobactam biosynthesis sfk01100   Metabolic pathways sfk01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:sfk00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     KY5_0492c  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:sfk01008]     KY5_0492c Polyketide biosynthesis proteins [BR:sfk01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     KY5_0492c BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  ATL25510 UniProt:  A0A291Q1A9 LinkDB All DBs Position complement(582414..582632) Genome browser AA seq 72 aa AA seqDB search MANPFENEEGQYLVLVNDEEQHSLWPATIEVPAGWRTAHGADSRGECLAYVERSWTDMRP AGLRREMDEVAS NT seq 219 nt NT seq  +upstreamnt  +downstreamnt atggcgaatcccttcgaaaacgaagagggccagtatctggtcctcgtcaacgacgaggag cagcactccttgtggcccgccacgatcgaggtgcccgcgggctggcgcacggcgcacggc gcggacagccgcggcgagtgcctcgcgtacgtcgagcggagctggaccgacatgcgcccc gcgggcctgcgccgtgagatggacgaggtggcctcgtag

DBGET integrated database retrieval system