Streptomyces graminofaciens: SGFS_025010 Help Entry SGFS_025010       CDS       T09325                                  Name (GenBank) Protein mbtH   KO K05375   MbtH protein Organism sgrf  Streptomyces graminofaciens Pathway sgrf00261   Monobactam biosynthesis sgrf01100   Metabolic pathways sgrf01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:sgrf00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     SGFS_025010  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:sgrf01008]     SGFS_025010 Polyketide biosynthesis proteins [BR:sgrf01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     SGFS_025010 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  BBC31207 LinkDB All DBs Position complement(2753191..2753400) Genome browser AA seq 69 aa AA seqDB search MTNPFENPDGTYRVLANDEGQHSLWPDFTAVPAGWTTVFGPDSRTACLEYVEREWTDLRP KSLVRAMGE NT seq 210 nt NT seq  +upstreamnt  +downstreamnt atgaccaaccccttcgagaaccccgacggcacctaccgggtcctggccaacgacgaaggc cagcactcgctgtggcccgacttcaccgccgtgcccgccggctggaccaccgtcttcggc ccggacagccgcaccgcctgcctggagtacgtcgagcgcgagtggaccgacctgcgcccc aagagcctcgtccgggccatgggcgagtga

DBGET integrated database retrieval system