Streptomyces hawaiiensis: CEB94_36205 Help Entry CEB94_36205       CDS       T06917                                  Name (GenBank) MbtH family protein   KO K05375   MbtH protein Organism shaw  Streptomyces hawaiiensis Pathway shaw00261   Monobactam biosynthesis shaw01100   Metabolic pathways shaw01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:shaw00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     CEB94_36205  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:shaw01008]     CEB94_36205 Polyketide biosynthesis proteins [BR:shaw01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     CEB94_36205 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  QCD59644 UniProt:  A0A6G5RP67 LinkDB All DBs Position 7852009..7852221 Genome browser AA seq 70 aa AA seqDB search MSTNPFDDNEGRFLVLVNDEGQHSLWPSFAEVPGGWTIAFAENTREACLEYVETHWTDLR PKSLATAQDA NT seq 213 nt NT seq  +upstreamnt  +downstreamnt atgagcaccaaccccttcgacgacaacgaaggccgtttcctggtcctggtgaacgacgag ggccagcactccctctggccctccttcgccgaggtgcccgggggatggacgatcgccttc gccgagaacacccgcgaggcatgcctggagtacgtcgagacccactggaccgacctgcgc ccgaagtccctcgccacggcccaggacgcctga

DBGET integrated database retrieval system