Streptomyces koelreuteriae: KJK29_03490 Help Entry KJK29_03490       CDS       T09603                                  Name (GenBank) MbtH family protein   KO K05375   MbtH protein Organism skg  Streptomyces koelreuteriae Pathway skg00261   Monobactam biosynthesis skg01100   Metabolic pathways skg01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:skg00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     KJK29_03490  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:skg01008]     KJK29_03490 Polyketide biosynthesis proteins [BR:skg01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     KJK29_03490 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  QWB21717 LinkDB All DBs Position complement(769366..769578) Genome browser AA seq 70 aa AA seqDB search MSTNPFDDNEGRFLVLVNDEGQHSLWPSFAEVPGGWTIAFEENTREACLEYVETHWTDLR PRSLAATMDV NT seq 213 nt NT seq  +upstreamnt  +downstreamnt atgagcaccaaccccttcgacgacaacgagggccgcttcctggtcctggtgaacgacgag ggccagcactcactctggccgtcgttcgccgaggtacccgggggctggacgatcgccttc gaggagaacacccgggaagcgtgcctggagtacgtcgagacccactggacggacctgcgc ccgaggtccctcgccgcgacgatggacgtctga

DBGET integrated database retrieval system