Streptomyces phaeolivaceus: F9278_45085 Help Entry F9278_45085       CDS       T07107                                  Name (GenBank) MbtH family protein   KO K05375   MbtH protein Organism sphv  Streptomyces phaeolivaceus Pathway sphv00261   Monobactam biosynthesis sphv01100   Metabolic pathways sphv01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:sphv00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     F9278_45085  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:sphv01008]     F9278_45085 Polyketide biosynthesis proteins [BR:sphv01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     F9278_45085 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  QFR02146 UniProt:  A0A5P8KFU8 LinkDB All DBs Position 9908958..9909167 Genome browser AA seq 69 aa AA seqDB search MTNPFENPDGTYRVLANDEGQHSLWPDFTAVPAGWTTVFGPDSRTACLEYVEREWTDLRP KSLVRAMGE NT seq 210 nt NT seq  +upstreamnt  +downstreamnt atgaccaaccccttcgagaaccccgacggcacctaccgggtcctggccaacgacgagggc cagcactccctgtggcccgacttcaccgccgtacccgccggctggaccaccgtcttcggc ccggacagccgtaccgcctgcctggagtacgtcgaacgcgagtggaccgacctgcgcccc aagagcctcgtccgggccatgggcgaatga

DBGET integrated database retrieval system