Streptomyces tuirus: GCM10017668_62320 Help Entry GCM10017668_62320 CDS       T07360                                  Name (GenBank) protein mbtH   KO K05375   MbtH protein Organism stui  Streptomyces tuirus Pathway stui00261   Monobactam biosynthesis stui01100   Metabolic pathways stui01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:stui00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     GCM10017668_62320  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:stui01008]     GCM10017668_62320 Polyketide biosynthesis proteins [BR:stui01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     GCM10017668_62320 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  BCL24389 UniProt:  A0A7G1NNM7 LinkDB All DBs Position 6780480..6780692 Genome browser AA seq 70 aa AA seqDB search MSTNPFDDTEGRFLVLVNDEGQHSLWPSFAEVPGGWTIAFAENTREACLEYVETHWTDLR PRSLAASQDA NT seq 213 nt NT seq  +upstreamnt  +downstreamnt atgagcaccaaccccttcgacgacaccgaaggccggttcctcgtcctggtgaacgacgag ggccagcactccctctggccgtccttcgccgaggtccccgggggatggacgatcgccttc gccgagaacacccgcgaggcatgcctggagtacgtcgagacccactggacggacctgcgc ccccggtccctcgcagcgtcccaggacgcctga

DBGET integrated database retrieval system